life on mars

Did you see the stunning pictures of Mars sent from the rover Perseverance? It was amazing to see in high definition pictures from the surface of another planet. It was, however, more of a technological wonder than an aesthetic wonder. The innovation needed to make the pictures possible was a lot more impressive than the actual pictures. Maybe I’ve just become one of those annoying people who is hard to impress, but after a few minutes of looking at the pictures I wanted to change the channel.

One of the arguments for going to Mars – other than just satisfying the natural human desire to explore – is to investigate the possibility of life on the planet. Was there ever life on Mars? Is there currently any living thing on Mars? Would it ever be possible for life to exist on Mars in the future? The question made me wonder. What would be more likely for us to find on Mars? A simple mechanical contraption or a single-celled organism? Our intuition says that it is more likely that our mechanical rover would discover tiny living organisms. I wonder why. It doesn’t make any logical sense. A simple mechanical contraption (SMC) is significantly less complex than a single-celled organism (SCO). If it is assumed that life evolves from the simple to the complex, it stands to reason that we would discover the simpler entity of the two choices. The argument might be that SCO are more likely to be found as remnants of a previous population of life on Mars, but would not a previous population have also left behind some trace of SMC? This argument also doesn’t really solve the logical dilemma. It is logically and mathematically much more probable that we would discover that which is simpler. You realize that if a race of sentient beings tens of thousands of years into the future who have no memory of our existence explored Mars they would actually discover SMC. They would stumble across ancient mechanical devices on the surface of the Red Planet. And what would they conclude? Would they conclude that these SMC arrived in their form and function through a gradual and undirected process of evolutionary development, or would they conclude that these SMC were the effects of intelligence and intentionality? You know the answer.

This little thought experiment reveals our bias which is neither logical nor even scientific. When it comes to the complexities of life, many modern people are likely to believe that it is the byproduct of slow, mindless evolution over time. This leads us to unjustifiably believe that it’s more likely that living organisms might be discovered on Mars rather than the type of contraptions that we know are the byproduct of intelligence.

Information and the Existence of Intelligence

What we have here is an old-fashioned, but very effective, argument for the existence of an Intelligent Designer. Basically, there are three things known to exist in our universe: matter, energy, and information.* All three things demand and explanation for their existence, but information, in particular, requires an intelligence for its existence. The argument could be put in a very simple syllogism.

If information exists, then intelligence exists.

Information exists.

Therefore, intelligence exists.

The truth of the first premise is self-evident. The fact that you can read and make sense of this sentence demonstrates that what you are seeing is more than random images on a screen. You are interpreting the images on the screen in an intelligible way. This requires not only your intelligence, but it also requires your assumption that the images on the screen came from an intelligent (marginally) source with both intentionality and design. If the images on the screen didn’t originate with an intelligence, you would be unjustified in “making sense” of them. They would literally be meaningless.

The second premise is also self-evident. Obviously information exists. What must also be affirmed, however, is that neither Mars rovers nor the basic building blocks of life could exist without information.

Consider this binary conversion of ASCII code for: “When in the course of human events”

01010111011010000110010101101110001000000110100101101110001000000111010001101000011001010010000001000011010111101110101011100100111001101100101001000000110111101100110001000000110100001110101011011010110000101101110001000000011001010111011001100101011011100111010001110011001000000110100101110100

This is not just a stream of random 0s and 1s. This is information that is meaningful only because of both intelligence and intentionality.

What about this seemingly random series of letters? Does it contain information?

AGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGATCGTCGGCAACAAGTGGGAGGCTTACCTGGGGCTGCTGCAGGCCGAGTACACCGAGGGGTGAGGCGCGCGGGCCGGGGCTAGGGGCTGAGTCCGCCGTGGGGCGCGGGCCGGGGCTGGGGGCTGAGTCCCGCCCTGGGGTGCGCCGGGGCGGGAGGCGCAGCGCTGCCTGAGGCCAGCGCCCCATGAGCAGCTTCAGGCCCGGCTTCTCCAGCCCCGCTCTGTGATCTGCTTTCGGGAGAACC

This is merely a part of the genetic sequence for an RNA polymerase. The basic building blocks of life contain libraries worth of information. This genetic information contains instructions that are exponentially more complex than binary code. Yet many people in the modern world are convinced that while binary code is clearly the work of intelligence, genetic information is the product of mindless evolutionary accidents. This is not only unconvincing; it is illogical. If information exists in genetic material, then that information must be the product of intelligence.

It is manifestly clear that life is the product of intelligent design. This argument doesn’t necessarily get us all the way to the biblical God, but it does at least demonstrate that the belief in a Creator God is completely reasonable and rational.

*Philosophers like Aristotle argued that substances were made of both matter and form. I would say that information is a kind of “directed form.” I’m no Aristotle expert though.

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s